Sequence ID | >A171000815 |
Genome ID | CP001690 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Halogeometricum borinquense DSM 11551 PR 3 [CP001690] |
Start position on genome | 1281290 |
End posion on genome | 1281374 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gtctaactgc |
tRNA gene sequence |
GCGAGGGTGGCCGAGTCTGGAAAAGGCGGCGGACTCAAGATCCGCTCTCGTAGGAGTCCG |
Downstream region at tRNA end position |
gtgccgacga |
Secondary structure (Cloverleaf model) | >A171000815 Leu CAA c ACtt gtgccgacga G - C C - G G - C A - T G - C G - C G - C T A T C T C C C A C T G A G | | | | A T G C C G G T G G G C G | | | T T G A G G C A A A G TCTCGTAGGAGTCC G - C C - G G - C G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |