Sequence ID | >A171001130 |
Genome ID | CP001860 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloterrigena turkmenica DSM 5511 [CP001860] |
Start position on genome | 2360831 |
End posion on genome | 2360905 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ttcgacgcac |
tRNA gene sequence |
GCTCCGTTGGTGTAGTCCGGCCAATCATTTCGGCCTTTCGAGCCGATGACCTGGGTTCAA |
Downstream region at tRNA end position |
tgctgcaaac |
Secondary structure (Cloverleaf model) | >A171001130 Glu TTC c Attt tgctgcaaac G - C C - G T - A C - G C - G G - C T - A T A T G A C C C A C T G A G | | | | | A C T G T G C T G G G C G | | + T T G T C A T C C A A T TGAC T - A C - G G - C G - C C - G C A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |