Sequence ID | >A171001187 |
Genome ID | CP001868 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloferax mediterranei ATCC 33500 CGMCC 1.2087 [CP001868] |
Start position on genome | 1828792 |
End posion on genome | 1828709 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttcaatacgc |
tRNA gene sequence |
GCGAGGGTAGCTAAGTCAGGAAAAAGCGGCGGACTCAAGATCCGCTCCCGTAGGGGTCCG |
Downstream region at tRNA end position |
cgtttttccg |
Secondary structure (Cloverleaf model) | >A171001187 Leu CAA c Atcg cgtttttccg G - C C - G G - C A - T G - C G - C G - C T A T C T C C C A C T G A A | | | | A A A T C G G T G G G C G | | | T T G A A G C A A A G TCCCGTAGGGGTCC G - C C - G G - C G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |