Sequence ID | >A171001330 |
Genome ID | CP001939 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Thermosphaera aggregans DSM 11486 [CP001939] |
Start position on genome | 952043 |
End posion on genome | 952128 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tcattttgaa |
tRNA gene sequence |
GCGGGGATGCCCGAGCTTGGCCAAAGGGGCCGGGTTGAGGACCCGGTGGCGTAGGCCTGC |
Downstream region at tRNA end position |
ttctccagtt |
Secondary structure (Cloverleaf model) | >A171001330 Leu GAG a ACta ttctccagtt G - C C - G G - C G - C G - C G - C A - T T A T C A C C C A T C G A G | | | | | A T G C C C G T G G G C G | | | T T G A G G G C C A A G TGGCGTAGGCCTGC C - G C - G G - C G - C G - C T A T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |