Sequence ID | >A171001453 |
Genome ID | CP001994 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanohalophilus mahii DSM 5219 [CP001994] |
Start position on genome | 1709461 |
End posion on genome | 1709538 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tacatcatgt |
tRNA gene sequence |
GGGATAGTAGGGTAGCCTGGCCGATCCTCGAGCGTTTGGGACGCTTGGACTGCGGTTCAA |
Downstream region at tRNA end position |
ctattcttca |
Secondary structure (Cloverleaf model) | >A171001453 Pro TGG t ACCA ctattcttca G - C G - C G - C A - T T - A A - T G - C T A T G C G C C A C C G A A + | | | | A T T G G G T G C G G C G | | + T T G T C C T C C G A C GGAC G + T A - T G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |