Sequence ID | >A171001781 |
Genome ID | CP002117 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanolacinia petrolearia DSM 11571 [CP002117] |
Start position on genome | 850200 |
End posion on genome | 850126 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aggtaaaaac |
tRNA gene sequence |
GGGGTAGTAGGGTAGCCTGGTCCATCCTAGAGCGTTTGGGACGCTTTGACGGCAGTTCGA |
Downstream region at tRNA end position |
ggtctttttt |
Secondary structure (Cloverleaf model) | >A171001781 Pro TGG c Atca ggtctttttt G - C G - C G - C G - C T - A A - T G - C T A T C C G T C A C C G A A | | | | | G T T G G G G G C A G C G | | + T T G T C C T T C C A A TGAC G + T A - T G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |