Sequence ID | >A171002089 |
Genome ID | CP002588 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Archaeoglobus veneficus SNP6 [CP002588] |
Start position on genome | 8063 |
End posion on genome | 8133 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
agctcatcaa |
tRNA gene sequence |
GCGGTCGTAGTCTAGCGGTAGGACACGGGCCTCCCGAGCCCGTTGCCCGGGTTCGAATCC |
Downstream region at tRNA end position |
atgtctattt |
Secondary structure (Cloverleaf model) | >A171002089 Gly CCC a Atca atgtctattt G - C C - G G - C G - C T + G C - G G - C T A T G G C C C A G A A | | | | | G C T C T G C C G G G C G + | | | T T G G G A C T A A TTGC C - G G - C G - C G - C C - G C A T G C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |