Sequence ID | >A171002204 |
Genome ID | CP002737 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanotorris igneus Kol 5 [CP002737] |
Start position on genome | 815918 |
End posion on genome | 815992 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ttgcttatgt |
tRNA gene sequence |
GGGCCCATGGTCTAGCTGGCTATGACATCGCCCTTACAAGGCGAAGGTCGCCGGTTCGAA |
Downstream region at tRNA end position |
attttatttt |
Secondary structure (Cloverleaf model) | >A171002204 Val TAC t ACta attttatttt G - C G - C G - C C - G C - G C - G A - T T A T C G G C C A C G A G | | | | | G T T C T G G C C G G C G | | | T T G T G A C C T A A AGGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |