Sequence ID | >A171002294 |
Genome ID | CP002779 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Pyrococcus yayanosii CH1 [CP002779] |
Start position on genome | 587130 |
End posion on genome | 587217 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gcgggacgga |
tRNA gene sequence |
GCGGGGGTTGCCGAGCCTGGTCAAAGGCGCGGGATTGAGGGTCCCGTCCCGTAGGGGTTC |
Downstream region at tRNA end position |
tttacttctg |
Secondary structure (Cloverleaf model) | >A171002294 Leu GAG a ACCA tttacttctg G - C C - G G - C G - C G - C G - C G - C T A T G C C C C A C C G A T | | | | | A T G C C G C G G G G C G | | | T T G A G G C T C A A G TCCCGTAGGGGTTC C - G G - C G - C G - C A - T T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |