Sequence ID | >A171002297 |
Genome ID | CP002779 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Pyrococcus yayanosii CH1 [CP002779] |
Start position on genome | 963448 |
End posion on genome | 963525 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gatagtggga |
tRNA gene sequence |
GCCCCGGTGGTGTAGCCCGGTCAAACATGCGGGCCTTTCGAGCCCGCGCCCCGGGTTCAA |
Downstream region at tRNA end position |
aaaacctcct |
Secondary structure (Cloverleaf model) | >A171002297 Glu TTC a ACCA aaaacctcct G - C C - G C - G C - G C - G G - C G - C T A T G G C C C A C C G A G | | | | | A C T G T G C C G G G C G | | | + T T G A C A T T C A A G CGCC C - G G - C G - C G - C C - G C A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |