Sequence ID | >A171002508 |
Genome ID | CP002913 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanococcus maripaludis X1 [CP002913] |
Start position on genome | 1686640 |
End posion on genome | 1686554 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tattttaagT |
tRNA gene sequence |
GCAGGGGTTGTCGAGCCTGGCCAAAGATGCAGGACTTAGAATCCTGTCCAGTAGTGGTTC |
Downstream region at tRNA end position |
tagtaatatt |
Secondary structure (Cloverleaf model) | >A171002508 Leu TAG T ATta tagtaatatt G - C C - G A - T G - C G - C G - C G - C T A T G T C C C A C C G A T | | | | | A T G C T G C A G G G C G | | + T T G A G A T C C A A G TCCAGTAGTGGTTC C - G A - T G - C G - C A - T C A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |