Sequence ID | >A171003567 |
Genome ID | CP004050 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanobrevibacter sp. AbM4 [CP004050] |
Start position on genome | 1851435 |
End posion on genome | 1851359 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
taattcgtaT |
tRNA gene sequence |
GCTCCGTTGGTGTAGTCCGGCCAATCATTCTGGCCTTTCGAGCCGGAGACTCGGGTTCGA |
Downstream region at tRNA end position |
ttattttagt |
Secondary structure (Cloverleaf model) | >A171003567 Glu TTC T ATtt ttattttagt G - C C - G T - A C - G C - G G - C T - A T A T A G C C C A C T G A G | | | | | G C T G T G T C G G G C G | | + T T G T C A T C C A A T AGAC C - G T + G G - C G - C C - G C A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |