Sequence ID | >A171003593 |
Genome ID | CP004144 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina mazei Tuc01 [CP004144] |
Start position on genome | 3068489 |
End posion on genome | 3068573 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tccaaaaagc |
tRNA gene sequence |
GCGGGAGTAACCAAGCGGTCAACGGTGGCAGACTCAAGATCTGTTCGTGCAGACGTTCAG |
Downstream region at tRNA end position |
gaaattctca |
Secondary structure (Cloverleaf model) | >A171003593 Leu CAA c ACCt gaaattctca G - C C - G G - C G - C G - C A - T G - C T A T T T C C C A C G A A | + | | | G G A C C A A G G G G C G | | | T T T C G G T C A A G TCGTGCAGACGTTC G + T C - G A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |