Sequence ID | >A171003828 |
Genome ID | CP006577 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Archaeoglobus fulgidus DSM 8774 [CP006577] |
Start position on genome | 1971977 |
End posion on genome | 1971904 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tcattacaga |
tRNA gene sequence |
GGGGCCGTAGGGTAGCCTGGTGATCCTCTCGGCTTTGGGAGCCGGTGACCCGAGTTCAAA |
Downstream region at tRNA end position |
ttgaactggc |
Secondary structure (Cloverleaf model) | >A171003828 Pro TGG a Atca ttgaactggc G - C G - C G - C G - C C - G C - G G - C T A T G G C T C A C C G A A | | | | | A T T G G G C C G A G C G | | + T T G T C C T T G A C TGAC T + G C - G G - C G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |