Sequence ID | >A171004073 |
Genome ID | CP006977 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Sulfolobus acidocaldarius SUSAZ [CP006977] |
Start position on genome | 749418 |
End posion on genome | 749504 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taatggtagT |
tRNA gene sequence |
GCGGGGGTGCCCGAGCAAGGTCAAAGGGGGCGGACTGAGGCTCCGCTGGTGTAGGCCTGC |
Downstream region at tRNA end position |
tggggacact |
Secondary structure (Cloverleaf model) | >A171004073 Leu GAG T ATtg tggggacact G - C C - G G - C G - C G - C G - C G - C T G T C A C C C A A C G A G | | | | | A A G C C C G T G G G C G | | | T T G A G G G T C A A G TGGTGTAGGCCTGC G - C C - G G - C G - C A - T C C T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |