Sequence ID | >A171004598 |
Genome ID | CP009502 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina thermophila CHTI-55 [CP009502] |
Start position on genome | 2324297 |
End posion on genome | 2324220 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
agtacccctT |
tRNA gene sequence |
GGGATAGTAGGGTAGCTTGGTCCATCCTCGAGCGTTTGGGACGCTTGGACCGCGGTTCAA |
Downstream region at tRNA end position |
catattatct |
Secondary structure (Cloverleaf model) | >A171004598 Pro TGG T ATCa catattatct G - C G - C G - C A - T T - A A - T G - C T A T G C G C C A T C G A A | | | | | A T T G G G C G C G G C G | | + T T G T C C T T C C A C GGAC G + T A - T G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |