Sequence ID | >A171004677 |
Genome ID | CP009504 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina sp. WH1 [CP009504] |
Start position on genome | 3243417 |
End posion on genome | 3243490 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
aagacagtaT |
tRNA gene sequence |
GCGACCGTGGTTTAGTGGCTATGACCTGAGCTTCCCAAGCTTAGAACCCGGGTTCGAATC |
Downstream region at tRNA end position |
caggcttttt |
Secondary structure (Cloverleaf model) | >A171004677 Gly CCC T ATtt caggcttttt G - C C - G G - C A - T C - G C - G G - C T A T G G C C C A T G A G | | | | | G G T T T G C C G G G C G + | | T T C T G A C T A C GAAC T - A G + T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |