Sequence ID | >A171004807 |
Genome ID | CP009506 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina siciliae T4/M [CP009506] |
Start position on genome | 1580685 |
End posion on genome | 1580611 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttatctgcct |
tRNA gene sequence |
GCCCAGGTAGCTCAGTGGGAGAGCGCTGCCCTGAAGAGGCAGTTGTCCCCGGTTCGAATC |
Downstream region at tRNA end position |
taaaaacgaa |
Secondary structure (Cloverleaf model) | >A171004807 Phe GAA t ACCA taaaaacgaa G - C C - G C - G C - G A - T G - C G + T T A T G G G C C A G A A | | | | | G T C T C G C C C G G C G | | | | T T G G A G C G A G TTGTC C - G T - A G - C C - G C - G C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |