Sequence ID | >A171005145 |
Genome ID | CP009514 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina mazei C16 [CP009514] |
Start position on genome | 1873227 |
End posion on genome | 1873298 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
caatccatgt |
tRNA gene sequence |
GCCGTCGTGGCTTAGCGGTATAGCGGCTGATTCGTAATCAGCAGGCCGAGGGTTCAAATC |
Downstream region at tRNA end position |
tgttttcctt |
Secondary structure (Cloverleaf model) | >A171005145 Thr CGT t Tttt tgttttcctt G - C C - G C - G G - C T + G C - G G - C T A T C T C C C A G A G | | | | | A C T T C G G A G G G C G | | | T T G T A G C T A G AGGCC G - C C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |