Sequence ID | >A171005261 |
Genome ID | CP009516 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanosarcina horonobensis HB-1 = JCM 15518 [CP009516] |
Start position on genome | 4968033 |
End posion on genome | 4968107 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
aacaatgcgt |
tRNA gene sequence |
GGGCCCGTAGCTTAGTCAGGCAGAGCGATGGACTCTTAATCCATAGGCCGGGGGTTCAAA |
Downstream region at tRNA end position |
tatcatattt |
Secondary structure (Cloverleaf model) | >A171005261 Lys CTT t GCta tatcatattt G - C G - C G - C C - G C - G C - G G - C T A T T T C C C A T G A A + + | | | A C T T C G G G G G G C A + | | | T T G G A G C G C A G AGGCC A - T T - A G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |