Sequence ID | >A171005686 |
Genome ID | CP009552 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Geoglobus acetivorans SBH6 [CP009552] |
Start position on genome | 1136750 |
End posion on genome | 1136675 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
taatgcagga |
tRNA gene sequence |
GGGCCCGTGGCTCAGCATGGATAGAGCGACGGCCTTCTAAGCCGTAGATCCCGGGTTCAA |
Downstream region at tRNA end position |
attatttatt |
Secondary structure (Cloverleaf model) | >A171005686 Arg TCT a GCtc attatttatt G - C G - C G + T C - G C - G C - G G - C T A T G G C C C A A C G A G | | | | | A T C T C G C C G G G C G | | | | T T G G A G C A T A G AGATC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |