Sequence ID | >A171005803 |
Genome ID | CP010529 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloarcula sp. CBA1115 [CP010529] |
Start position on genome | 2378017 |
End posion on genome | 2378102 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tagaacgcgt |
tRNA gene sequence |
GTCGTGGTAGCCAAGCCTGGCCCAAGGCGCAGGGTTGCTAACTCTGTGGCGTACAGCCTC |
Downstream region at tRNA end position |
acccatcagt |
Secondary structure (Cloverleaf model) | >A171005803 Ser GCT t GCtc acccatcagt G - C T - A C - G G - C T - A G - C G - C T A T G C C C C A C C G A A | | | | | G T A C C G C G G G G C G | | | T T G A G G C C C C A G TGGCGTACAGCCTC C - G A - T G - C G + T G - C T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |