Sequence ID | >A171005810 |
Genome ID | CP010529 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Haloarcula sp. CBA1115 [CP010529] |
Start position on genome | 3095663 |
End posion on genome | 3095579 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gcaagagcgc |
tRNA gene sequence |
GCGTGGGTAGCCAAGCCAGGCCAACGGCGCAGCGTTGAGGGCGCTGTCCCGTAGGGGTCC |
Downstream region at tRNA end position |
ctttgagcgc |
Secondary structure (Cloverleaf model) | >A171005810 Leu GAG c Attt ctttgagcgc G - C C - G G - C T - A G - C G - C G - C T A T T G G C C A C C G A A + | | | | G A A C C G G C C G G C G | | | T T G C G G C C C A A G TCCCGTAGGGGTCC C - G A - T G - C C - G G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |