| Sequence ID | >A171006312 |
| Genome ID | CP012175 |
| Phylum/Class | Thermoproteota |
| Species | Metallosphaera sedula ARS120-2 [CP012175] |
| Start position on genome | 2079492 |
| End posion on genome | 2079415 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
ctcataactt |
| tRNA gene sequence |
GCGGCCGTAGTCTAGCCTGGATTAGGACGCCTGCCTGCCACGCAGGAGGTCCCGGGTTCA |
| Downstream region at tRNA end position |
gttctccatt |
| Secondary structure (Cloverleaf model) | >A171006312 Gly GCC
t ACCt gttctccatt
G - C
C - G
G - C
G + T
C - G
C - G
G - C T A
T G G C C C A
C C G A A | | | | | A
T T C T G C C G G G C
G + | | | T T
G G G A C
A T T A G AGGTC
C - G
C - G
T - A
G - C
C - G
C C
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |