Sequence ID | >A171006635 |
Genome ID | CP015363 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Ferroplasma acidiphilum Y [CP015363] |
Start position on genome | 626516 |
End posion on genome | 626445 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
acagcaatca |
tRNA gene sequence |
GGGCTCATAGATCAGCGGTAGATCGCTTCCTTGGCATGGAAGAGGGCAGGGGTTCAAATC |
Downstream region at tRNA end position |
gcaatgtcac |
Secondary structure (Cloverleaf model) | >A171006635 Ala GGC a Atta gcaatgtcac G - C G - C G + T C - G T - A C - G A - T T A T T C C C C A G A A | | | | | A C C T A G A G G G G C G | | | | T T G G A T C T A G AGGGC C - G T - A T - A C - G C - G T T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |