Sequence ID | >A171007392 |
Genome ID | LN734822 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanobacterium formicicum [LN734822] |
Start position on genome | 402227 |
End posion on genome | 402311 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aattagcaca |
tRNA gene sequence |
GCAGGGGTGGTCGAGCGGTCAAAGGCGCTAGGTTGAGGGCCTAGTGGGTGAGTCCCTTCG |
Downstream region at tRNA end position |
gtatgaactt |
Secondary structure (Cloverleaf model) | >A171007392 Leu GAG a ACtt gtatgaactt G - C C - G A - T G - C G - C G - C G - C T A T T G C C C A C G A G + | | | | G G G C T G G C G G G C G | + | T T T A G G C C A A G TGGGTGAGTCCCTTC C - G T - A A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |