Sequence ID | >A171007643 |
Genome ID | LT549891 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Methanoculleus bourgensis [LT549891] |
Start position on genome | 292535 |
End posion on genome | 292461 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
taggcggaaa |
tRNA gene sequence |
GCCCCTGTAGCTCAGACTGGGAGAGCGCCAGACTGAAGATCTGGTTGTCCCCGGTTCAAA |
Downstream region at tRNA end position |
cgagcaactt |
Secondary structure (Cloverleaf model) | >A171007643 Phe GAA a ACtt cgagcaactt G - C C - G C - G C - G C - G T + G G - C T A T G G G C C A A G A A | | | | | A C C T C G C C C G G C T | | | | T T G G A G C G G A G TTGTC C - G C - G A - T G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |