Sequence ID | >A171007775 |
Genome ID | LT719092 |
Search identical group | |
Phylum/Class | Unclassified |
Species | Cuniculiplasma divulgatum PM4 [LT719092] |
Start position on genome | 1068436 |
End posion on genome | 1068521 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aatgaaaaaT |
tRNA gene sequence |
GCGAGGATGGCCCAGCGGTACGGCGGCAGCCTGCTAAGCTGTTTTTCCTATGGAAAGCGT |
Downstream region at tRNA end position |
aatgataatt |
Secondary structure (Cloverleaf model) | >A171007775 Ser GCT T GTCt aatgataatt G - C C - G G - C A - T G - C G - C A - T T A T C A C C C A G A G | | | | | G C C C C G G T G G G C G | | | T T G C G G C T A G TTTTCCTATGGAAAGC G + T C - G A - T G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |