| Sequence ID | >A178000047 |
| Genome ID | CP001400 |
| Phylum/Class | Thermoproteota |
| Species | Sulfolobus islandicus M.14.25 [CP001400] |
| Start position on genome | 1677413 |
| End posion on genome | 1677503 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
attttatgtt |
| tRNA gene sequence |
GGACCCGTAGCTCAGCCAGGACGGAGCGCCGGCCTTCTAAGCCGGCGGTCCCGGGTTCAA |
| Downstream region at tRNA end position |
atattatcac |
| Secondary structure (Cloverleaf model) | >A178000047 Arg TCT
t GCac atattatcac
G - C
G - C
A - T
C - G
C - G
C - G
G - C T A
T G G C C C A
C C G A A | | | | | A
A C T C G C C G G G C
G | | | | T T
G G A G C
A C G G CGGTC
C - G
C - G
G - C
G - C
C - G
C A
T A *
T C T
intron: position=38, length=15 (in A-loop)
GCGTCTAAGGGGGAT
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |