Sequence ID | >A178000267 |
Genome ID | CP002818 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Sulfolobus acidocaldarius Ron12/I [CP002818] |
Start position on genome | 563618 |
End posion on genome | 563517 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aattatgaat |
tRNA gene sequence |
GCCGCCGTAGCTCAGCACGGTCAGAGCGCCGGCCTCGTAAGCCGGTGGTCCCGGGTTCAA |
Downstream region at tRNA end position |
caggtgctat |
Secondary structure (Cloverleaf model) | >A178000267 Thr CGT t Ttcc caggtgctat G - C C - G C - G G - C C - G C - G G - C T A T G G C C C A A C G A A | | | | | A C C T C G C C G G G C G | | | | T T G G A G C T C A G TGGTC C - G C - G G - C G - C C - G C A T A * C G T intron: position=38, length=27 (in A-loop) AGGCCTAAGTAAGAAGTGATCCAGGAC |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |