Sequence ID | >A178000709 |
Genome ID | CP020477 |
Search identical group | |
Phylum/Class | Thermoproteota |
Species | Acidianus manzaensis YN-25 [CP020477] |
Start position on genome | 1505139 |
End posion on genome | 1505049 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aataattaat |
tRNA gene sequence |
GCCGCTGTAGCTCAGCTGGTAGAGCGCCGGCCTCGTAAGCCGGCGGTCGCGGGTCCGAGT |
Downstream region at tRNA end position |
ggtgaatata |
Secondary structure (Cloverleaf model) | >A178000709 Thr CGT t Tgat ggtgaatata G - C C - G C - G G - C C - G T - A G - C T G T C G C C C A C G A A | | | | | G T C T C G G C G G G C G | | | | T C G G A G C T A G CGGTC C - G C - G G - C G - C C - G C A T A * C G T intron: position=38, length=18 (in A-loop) AGGCTAGGTGTCAGTGAA |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |