| Sequence ID | >W131164829 |
| Genome ID | ARBC01000016 |
| Phylum/Class | Gammaproteobacteria |
| Species | Lamprocystis purpurea DSM 4197 [ARBC] |
| Start position on genome | 25979 |
| End posion on genome | 25903 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
cgcgtccacc |
| tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCACCTGAATGGGGTTCAGGTGGTCGGAGGTTCAAA |
| Downstream region at tRNA end position |
agtgactggg |
| Secondary structure (Cloverleaf model) | >W131164829 Pro GGG
c ACCA agtgactggg
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T T C T C C A
C G A A + | | | | A
C C G C G G G A G G C
T | | | | T T
G G C G C
G T A A TGGTC
C - G
C - G
T - A
G - C
A - T
A T
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |