Sequence ID | >W131034871 |
Genome ID | AJRV01000052 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio cholerae HC-62A1 [AJRV] |
Start position on genome | 43215 |
End posion on genome | 43139 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
cgcagcgttt |
tRNA gene sequence |
CGGTGAATAGCGCAGTTTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
tatttaaggc |
Secondary structure (Cloverleaf model) | >W131034871 Pro TGG t ACCA tatttaaggc C - G G - C G - C T - A G - C A - T A - T T A T C T C C C A T G A A | + | | | G T C G C G G G G G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |