Sequence ID | >W131108558 |
Genome ID | APGD01000057 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio cholerae O1 str. NHCC-010F [APGD] |
Start position on genome | 261 |
End posion on genome | 186 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
taaaacatgt |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCACTGGTTCGAAC |
Downstream region at tRNA end position |
ctctttaagc |
Secondary structure (Cloverleaf model) | >W131108558 Val TAC t ACCA ctctttaagc G - C G - C G - C C - G G - C A - T T - A C A T T G G C C A T G A A | | + | | G T C T C G A C T G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |