Sequence ID | >WENV011440 |
Genome ID | AACY020311045 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 1796 |
End posion on genome | 1874 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tacagtcctT |
tRNA gene sequence |
GGGTCTGTAGCTCAGTTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGTGGTTCAAA |
Downstream region at tRNA end position |
Cttcttcgcg |
Secondary structure (Cloverleaf model) | >WENV011440 Ile GAT T ACCA Cttcttcgcg G - C G - C G - C T - A C - G T - A G - C T A T C C A C C A T G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |