Sequence ID | >W131236562 |
Genome ID | AUML01000057 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Aquimarina muelleri DSM 19832 [AUML] |
Start position on genome | 6270 |
End posion on genome | 6193 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttttttattt |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTTATCGCGCCGCGTTTGGGACGCGGAGGTCGCAGGTTCGA |
Downstream region at tRNA end position |
atgtaaagtc |
Secondary structure (Cloverleaf model) | >W131236562 Pro TGG t ACTA atgtaaagtc C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A C C G A A | | | | | G C T G C G G C A G G C G | | | T T G T C G C T T A G AGGTC C - G C - G G - C C - G G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |