Sequence ID | >W131171818 |
Genome ID | ARGM01000049 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Salinispora pacifica CNT124 [ARGM] |
Start position on genome | 43526 |
End posion on genome | 43598 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
ccgagccaac |
tRNA gene sequence |
GGGCGATTAGCTCAGCGGGAGAGCGCTTCGTTCACACCGAAGAGGTCACTGGTTCGATCC |
Downstream region at tRNA end position |
tgaatatagg |
Secondary structure (Cloverleaf model) | >W131171818 Val CAC c ACgt tgaatatagg G - C G - C G - C C - G G - C A - T T - A C T T T G A C C A G A A | | | | | G C C T C G A C T G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A C - G G - C T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |