Sequence ID | >C171002120 |
Genome ID | CP009251 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium stationis 622 [CP009251] |
Start position on genome | 275571 |
End posion on genome | 275659 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtttcttctc |
tRNA gene sequence |
GGAGGATTCGACTAGCGGCCTATGTCACACGCCTGGAACGCGTGCGGGGTTCACGCCCCT |
Downstream region at tRNA end position |
gtgaaaatct |
Secondary structure (Cloverleaf model) | >C171002120 Ser GGA c GCCA gtgaaaatct G - C G - C A - T G - C G - C A - T T - A T A T C A C C C A C G A C | | | | | A G T C A G G T G G G C G | | | T T C T G T C C T A A CGGGGTTCACGCCCCTC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |