Sequence ID | >C171009171 |
Genome ID | CP011196 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Bordetella pertussis H810 [CP011196] |
Start position on genome | 547665 |
End posion on genome | 547749 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
aggcagcaaa |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCATGGTTCAGGTCCATGTGCCGCAAGGTGTGGA |
Downstream region at tRNA end position |
atacatactt |
Secondary structure (Cloverleaf model) | >C171009171 Leu CAG a ACCA atacatactt G - C C - G C - G C - G A - T G - C G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TGCCGCAAGGTGT C - G A - T T - A G - C G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |