Sequence ID | >C171012022 |
Genome ID | CP011708 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Bordetella pertussis H853 [CP011708] |
Start position on genome | 4022099 |
End posion on genome | 4022174 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ctctaccttt |
tRNA gene sequence |
TCCCCGATAGCTCAGTCGGTAGAGCGACGGACTGTTAATCCGCAGGTCGCTGGTTCGAGC |
Downstream region at tRNA end position |
gattccagaa |
Secondary structure (Cloverleaf model) | >C171012022 Asn GTT t GCCA gattccagaa T - A C - G C - G C - G C - G G - C A - T C G T C G A C C A T G A A | | | | | G C C T C G G C T G G C G | | | | T T G G A G C T A G AGGTC A C C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |