Sequence ID | >C171026694 |
Genome ID | CP013778 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Piscirickettsia salmonis PM51819A [CP013778] |
Start position on genome | 1243572 |
End posion on genome | 1243648 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gatattaata |
tRNA gene sequence |
GCCCCGGTGGCACAGCTGGATAGCGCGATCCCCTCCTAAGGGATAGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
actttataaa |
Secondary structure (Cloverleaf model) | >C171026694 Arg CCT a ACCA actttataaa G - C C - G C - G C - G C - G G - C G + T T A T T G T C C A C G A G | | | | | G T C A C G A C A G G C G | | | T T G G C G C A T A G AGGTC A - T T - A C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |