| Sequence ID | >C171029032 |
| Genome ID | CP013897 |
| Phylum/Class | Betaproteobacteria |
| Species | Bordetella pertussis J159 [CP013897] |
| Start position on genome | 6591 |
| End posion on genome | 6665 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
tccaagattt |
| tRNA gene sequence |
GCCCATGTGGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCACGCGTTCGATCC |
| Downstream region at tRNA end position |
tcgaattcta |
| Secondary structure (Cloverleaf model) | >C171029032 Thr GGT
t ACCA tcgaattcta
G - C
C - G
C - G
C - G
A - T
T - A
G - C C T
T T G C G C A
G A G | | | | | G
T C T C G A C G C G C
G | | | | T T
G G A G C
T A A AGGTC
C - G
T - A
C - G
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |