Sequence ID | >C171036696 |
Genome ID | CP015191 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium pseudotuberculosis 48 [CP015191] |
Start position on genome | 1364225 |
End posion on genome | 1364300 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
cagttgcaat |
tRNA gene sequence |
GCGGATGTAGCGCAGTTGGTAGCGCATCACCTTGCCAAGGTGAGGGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
cgttcacatt |
Secondary structure (Cloverleaf model) | >C171036696 Gly GCC t TCCA cgttcacatt G - C C - G G - C G - C A - T T + G G - C T A T T G C T C A T G A A + | | | | G T C G C G G C G A G C G | | | | T T G G C G C T A A GGGTC T - A C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |