Sequence ID | >C171044754 |
Genome ID | CP015972 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Xanthomonas citri pv. glycines str. 12-2 [CP015972] |
Start position on genome | 4931262 |
End posion on genome | 4931187 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtacgacatc |
tRNA gene sequence |
GCCGCTTTAGCTCAGTCGGTAGAGCAACTGATTTGTAATCAGTAGGTCGTCCGTTCGATT |
Downstream region at tRNA end position |
tccctcgtag |
Secondary structure (Cloverleaf model) | >C171044754 Thr TGT c ACCA tccctcgtag G - C C - G C - G G - C C - G T - A T - A T T T C A G G C A T G A A | | | | | G C C T C G G T C C G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |