Sequence ID | >C171049932 |
Genome ID | CP016460 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Blastomonas sp. RAC04 [CP016460] |
Start position on genome | 3765260 |
End posion on genome | 3765184 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttggccagac |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGCCACTGGTTCGAA |
Downstream region at tRNA end position |
tttctccaca |
Secondary structure (Cloverleaf model) | >C171049932 Arg CCG c ACCA tttctccaca G - C C - G A - T C - G C - G C - G G - C T A T T G A C C A C G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C A T A G AGGCC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |