Sequence ID | >C171059518 |
Genome ID | CP017253 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium taeniosporum 1/k [CP017253] |
Start position on genome | 395155 |
End posion on genome | 395230 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gccaatatat |
tRNA gene sequence |
GGTTCACTAGCTCAGTCGGTAGAGCACATGACTTTTAATCATGGTGTCCCGGGTTCGATT |
Downstream region at tRNA end position |
aatttaaaat |
Secondary structure (Cloverleaf model) | >C171059518 Lys TTT t ACCA aatttaaaat G - C G - C T + G T - A C - G A - T C - G T T T G G C C C A T G A A | | | | | G C C T C G C C G G G C G | | | | T T G G A G C T A A GTGTC C - G A - T T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |