Sequence ID | >C171060462 |
Genome ID | CP017297 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Brachybacterium sp. P6-10-X1 [CP017297] |
Start position on genome | 2517772 |
End posion on genome | 2517859 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cacgagcgct |
tRNA gene sequence |
GGAGGATTCGCCTAGCGGCCTATGGCGCACGCCTGGAACGCGTGTTGGGTTCACGCCCTC |
Downstream region at tRNA end position |
aaaaaatgcc |
Secondary structure (Cloverleaf model) | >C171060462 Ser GGA t GCCG aaaaaatgcc G - C G - C A - T G - C G - C A - T T - A T A T C C C C C A C G A C | | | | | G G T C C G G G G G G C G | | | T T C T G G C C T A G TTGGGTTCACGCCCTC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |