| Sequence ID | >C171060619 |
| Genome ID | CP017311 |
| Phylum/Class | Betaproteobacteria |
| Species | Hydrogenophaga sp. PBC [CP017311] |
| Start position on genome | 4286351 |
| End posion on genome | 4286276 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
catcaatcct |
| tRNA gene sequence |
GGGGGATTAGCTCAGCTGGGAGAGCACCTGCTTTGCAAGCAGGGGGTCGTCGGTTCGATC |
| Downstream region at tRNA end position |
cttcctggtc |
| Secondary structure (Cloverleaf model) | >C171060619 Ala TGC
t ACCA cttcctggtc
G - C
G - C
G + T
G - C
G - C
A - T
T - A C T
T C T G C C A
C G A A | | | | G
T C T C G G T C G G C
G | | | | T T
G G A G C
G A A GGGTC
C - G
C - G
T - A
G - C
C - G
T A
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |