Sequence ID | >C171063349 |
Genome ID | CP017479 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Flavobacterium gilvum EM1308 [CP017479] |
Start position on genome | 86249 |
End posion on genome | 86173 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gtaatgagag |
tRNA gene sequence |
GCCGATGTAGCTCAGCTGGCTAGAGCAGCTGATTTGTAATCAGCAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
aaaaaccatc |
Secondary structure (Cloverleaf model) | >C171063349 Thr TGT g TCAA aaaaaccatc G - C C - G C - G G - C A - T T - A G + T T G T C T C C C A C G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |