Sequence ID | >C171063637 |
Genome ID | CP017572 |
Search identical group | |
Phylum/Class | Chloroflexota |
Species | Dehalococcoides mccartyi [CP017572] |
Start position on genome | 877686 |
End posion on genome | 877610 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gttatcaaat |
tRNA gene sequence |
GGGCCATTAGCTCAGTTGGTTAGAGCGCAGTCCTGATAAGACTGAGGTCCTTGGTTCGAG |
Downstream region at tRNA end position |
taaagctaaa |
Secondary structure (Cloverleaf model) | >C171063637 Ile GAT t ACCA taaagctaaa G - C G - C G - C C - G C - G A - T T - A A G T G A A C C A T G A A | | | | | G T C T C G C T T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T G - C T - A C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |